Q4
|
|||||||||||||||||||||||||||||||||||||||||
Class
|
ER surface | ||||||||||||||||||||||||||||||||||||||||
Raw sequence
|
GAATTCAAGCGCTTGAATTCAAGCCTTGAACAGAAAGTGAAGCTTGCAGATG CTAAATCTAAGGAAACTGAGTCTACGGGAAAAGAGGAAGAAGTAGAAGTGA AATCTCGAGACAGTGACTTATCTTTTTCAAATCCAAAGCAAACTAAGATCAAG AAGAACTTGGATGCTGCTTCGTCTTCAGGGCACGTTATGATTCAGAAAGCTG AAACATGGCATCTCATGACATTGAAGATCGCACTTGGAGTGGCTCTTGTCTC TGTCATTCTAGGTATCATTGTTGGGAAAAATTATTGATTTCTTTTTGTTATATT TATGAAAGATTTGTTTGTTTGATTGTTTCGTGGTTCTAAGAATTTTTGCTTCTA CCAAAAAAAAAAAAGCTT | ||||||||||||||||||||||||||||||||||||||||
Gene name
|
Novel | ||||||||||||||||||||||||||||||||||||||||
Genbank accession #
|
AAB71445 | ||||||||||||||||||||||||||||||||||||||||
Frame
|
1 | ||||||||||||||||||||||||||||||||||||||||
Gene function
|
Unknown | ||||||||||||||||||||||||||||||||||||||||
Comments
|
Predicted carboxy terminal membrane anchor. Small stretch rich in Lysine, may be te ER retention signal? Novel, with similarity to stretch of putative A. thaliana Myosin II heavy chain TMpred Analysis: Sequence: EFK...KNY, length: 98 Prediction parameters: TM-helix length between 17 and 33 1.) Possible transmembrane helices The sequence positions in brackets denominate the core region. Only scores above 500 are considered significant. Inside to outside helices : 1 found from to score center 75 ( 77) 95 ( 95) 2054 85 Outside to inside helices : 1 found from to score center 76 ( 76) 94 ( 94) 2317 84 2.) Table of correspondences Here is shown, which of the inside->outside helices correspond to which of the outside->inside helices. Helices shown in brackets are considered insignificant. A "+"-symbol indicates a preference of this orientation. A "++"-symbol indicates a strong preference of this orientation. inside->outside | outside->inside 75- 95 (21) 2054 | 76- 94 (19) 2317 ++ 3.) Suggested models for transmembrane topology These suggestions are purely speculative and should be used with extreme caution since they are based on the assumption that all transmembrane helices have been found. In most cases, the Correspondence Table shown above or the prediction plot that is also created should be used for the topology assignment of unknown proteins. 2 possible models considered, only significant TM-segments used -----> STRONGLY prefered model: N-terminus outside 1 strong transmembrane helices, total score : 2317 # from to length score orientation 1 76 94 (19) 2317 o-i ------> alternative model 1 strong transmembrane helices, total score : 2054 # from to length score orientation 1 75 95 (21) 2054 i-o |
||||||||||||||||||||||||||||||||||||||||
Status
|
T2, GYC, R | ||||||||||||||||||||||||||||||||||||||||
Images
|
|||||||||||||||||||||||||||||||||||||||||
![]() |
|||||||||||||||||||||||||||||||||||||||||
|